Skip to Main content

HFE (Gene)
HFE gene testing should replace more expensive HLA typing previously used to screen siblings.
From: Encyclopedia of Gastroenterology, 2004
Related terms:
Allele
Transferrin
Iron Overload
Hepcidin
Hemojuvelin
Genetic Carrier
Nested Gene
Mutation
Gene Mutation
Iron Absorption
View all Topics
Iron Metabolism: Hepcidin
Martha-Spyridoula Katsarou, ... Nikolaos Drakoulis, in Vitamins and Hormones, 2019
2.5 Prevention
Diagnosis strategies for hereditary hemochromatosis are not standardized, suggesting genetic predisposition as well as timely detection of clinical symptoms (Yen et al., 2006). Genotypic testing of the more frequent mutations of the HFE gene and their detection can lead to the avoidance of liver biopsy in selected cases and can help make an early diagnosis (Adams et al., 2013; Bassett, 2010; Olynyk et al., 1999). Since hemochromatosis treatment relies on therapeutic phlebotomy and the use of chelating agents iron have limited indications, early diagnosis and initiation of treatment, prior to the development of clinical symptoms, in particular liver cirrhosis, contributes significantly to the achievement of a normal life expectancy. Another promising way in treating hemochromatosis or iron disorders in general is fine-tuning Hamp expression thus correcting the hepcidin-FPN axis, since deregulation of this particular protein is closely associated with iron overload or deficiency (Liu et al., 2016).
Also a Proton Pump Inhibitors (PPIs) treatment significantly reduces the need for phlebotomies in p.C282Y homozygous patients. In view of the known long-term safety profile of PPI, they can be a valuable addition to standard therapy (Vanclooster, van Deursen, Jaspers, Cassiman, & Koek, 2017).
View chapterPurchase book
Hemochromatosis
Maha Guindi MD, in Practical Hepatic Pathology, 2011
HFE
HFE gene mutations characterize type 1 HH and contribute to the majority of cases of clinical HH.1 The gene encodes for a ubiquitously expressed major histocompatibility complex (MHC) class I–like mole, which, like other molecules in this class, is complexed with β-2 microglobulin on cellular membranes, but differs from them by the absence of a peptide-binding groove necessary for antigen presentation. The HFE/β-2 microglobulin complex is localized adjacent to and binds with TFR2, which facilitates cellular uptake of iron. Expression of the HFE protein is particularly strong on hepatocytes and cells in the deeper portions of duodenal crypts; however, because neither site is involved in absorption of iron, these localizations fail to explain a simple cause-and-effect relationship between HFE and the increased iron absorption that occurs in HH. The control of iron absorption by HFE is therefore indirect and is now known to occur through modulation of hepcidin,12 a suppressor of iron absorption produced by the liver. The abundance of HFE on hepatocyte membranes and the production of hepcidin by the liver is in keeping with the age-old observation that the liver plays a central role in iron homeostasis and the development of HH.
View chapterPurchase book
Hereditary Hemochromatosis
David J. Brandhagen, in Encyclopedia of Gastroenterology, 2004
Role of Liver Biopsy
HFE gene testing may eliminate the need for a liver biopsy in many cases. Traditionally, a liver biopsy has been performed in patients with iron overload to confirm the diagnosis of HH and to exclude cirrhosis. Patients who are homozygous for the C282Y mutation with an elevated serum iron and transferrin saturation without secondary iron overload do not need a liver biopsy to confirm the diagnosis of HH. Liver biopsy still remains the "gold standard" for assessing the degree of fibrosis. Definitively excluding cirrhosis is important because of the increased risk of developing hepatocellular carcinoma. The risk for cancer persists even after patients are depleted of excess iron stores. In such patients, screening with an ultrasound scan and α-fetoprotein every 6 months may be appropriate.
There may be a subset of HH patients whose risk of cirrhosis is minimal, and a liver biopsy would be unnecessary. Several recent studies have confirmed that certain predictive noninvasive assessments are accurate in excluding cirrhosis in C282Y homozygotes. In these studies, cirrhosis was extremely uncommon in C282Y homozygotes who had serum ferritin levels lower than 1000 μg/liter and normal aspartate aminotransferase values. A serum ferritin of <1000 μg/liter seems to be the best predictor of the absence of cirrhosis in C282Y homozygotes. The positive predictive value of a serum ferritin of >1000 μg/liter is poor, however, because only about 50% of those with serum ferritin values >1000 μg/liter had cirrhosis. A recent study found that cirrhosis was present in approximately 80% of C282Y homozygotes with serum ferritin of >1000 μg/liter and a platelet count <200 k and an elevated AST. Until these findings are confirmed, a liver biopsy is advisable in C282Y homozygotes with serum ferritin values >1000 μg/liter to definitely assess for the presence of cirrhosis. There are limited data on noninvasive predictors of cirrhosis for non-C282Y homozygotes. A liver biopsy may be necessary in this group of patients to confirm the diagnosis of HH and exclude cirrhosis.
View chapterPurchase book
Hemochromatosis
Ernest Beutler, Pauline Lee, in Molecular Diagnostics, 2010
HFE
The HFE gene is usually the first to be examined, and the focus of this examination will be the common C282Y and H63D mutation. The search for these mutations can be performed using a variety of methods, as described earlier. The choice of method will generally depend upon the number of individual DNA samples to be examined and the availability of equipment in the laboratory.
If less common mutations of HFE are being sought, direct sequencing of HFE can be performed. The primers and temperatures for amplification are listed in Table 16.2. Amplification with HFE ProA → ProB (Table 16.2) includes the HNF3B/HFH2 promoter motifs, and the HFE ProC → ProD fragment includes the CCAAT and TATA boxes in the HFE promoter region. The coding region can be amplified with HFE exon 1–6 primer pairs. Amplification is performed after an initial denaturation step of 96°C for 5 minutes, at 95°C for 1 minute, 60°C for 30 seconds, and 72°C for 1 minute for 30 cycles. Following purification of the amplified DNA products, direct sequencing is performed using the original amplification and internal primers. The dHPLC method described by Biasiotto et al. (2003) is one of several published methods for the identification of HFE mutations (Christiansen et al., 1999; Fruchon et al., 2003; Le Gac et al., 2001). HFE mutation analyses using other techniques including RFLP (Aslam and Standen, 1997), amplification refractory mutation system (ARMS; Baty et al., 1998), single-strand conformational polymorphism (SSCP; Bosserhoff et al., 1999), fluorescent-based methods (Bernard et al., 1998; Fortina et al., 2000; Kyger et al., 1998), and others (Devaney et al., 2001; Donohoe et al., 2000; Guttridge et al., 2000; Turner et al., 2001) have also been described.
Table 16.2. Primers and Conditions for HFE PCR and dHPLC
PCRPrimer NameSequencePositionSize (bp)PCR Temp (°C)DMSOHFE ProA+AGCCGGAGCTCTGAAGCAG−1221→1203*566595%HFE ProB−GTCACTAAGACAGCCACTGG−656 → −675HFE ProC+GGGCATGTGCCACCTTAGG−871 → −853616605%HFE ProD+GAAACACTAGGTGATCCAGTG−216 → −196HFE Ex IFCATTGCGAAGCTACTTTCCC−277 → −25841161HFE Ex 1RAGTTTCGATTTTTCCACCCCCivs1 + 58→ivs1 + 38HFE Ex 2FTGAGGACCAGACACAGCTGATivs1 − 107 → ivs1 − 8797761HFE Ex 3RCAGAATTTGGAGAGGCACACAGivs3 + 121 → ivs3 + 100HFE Ex 4FGGTGTCTCTCCTGTAGCTTGTivs3 − 136 → ivs3 − 11688561HFE Ex 5RGGTGCTCTGAAGATGTTTGTTGivs5 + 201 → ivs5 + 180HFE Ex6FTGGGTGAATGAGGAAAATAAGGivs5 − 89 → ivs5 − 6834061HFE Ex6RCTAGGGATCACCGGCATGTGA + 220 → TGA + 203**HFE Ex 3FACAGCTGGAAGTCTGAGGTCTivs2 − 138 → ivs2 − 118SequencingdHPLCPrimer NameSequence#PositionSize (bp)PCR Temp (°C)dHPLC Temp (°C)HFE Ex 2 dFGGTGTGTGGAGCCTCAACATivs1 − 70 > ivs1 − 513345761.1HFE Ex 2 dRCCTTGCTGTGGTTGTGATTTTCCc.340 − c.318HFE Ex 3 dFGGACCTATTCCTTTGGTTGCAivs2 − 47 > ivs2 − 273715763.5HFE Ex 3 dRTCCACTCTGCCACTAGAGTAivs3 + 48 > ivs3 + 29HFE Ex 4 dFAGTTCCAGTCTTCCTGGCAAivs3 − 65 > ivs3 − 473685762.4HFE Ex 4 dRAGCTCCTGGCTCTCATCAGTivs4 + 27 > ivs4 + 8
*Position from ATG.**Position from TGA stop codon.#Biasiotto et al., 2003.
View chapterPurchase book
Hemochromatosis
Nicholas J. Procaccini MD, JD, MS, Kris V. Kowdley MD, FACP, in Handbook of Liver Disease (Fourth Edition), 2018
HFE Hemochromatosis (Type 1)
1.
The HFE gene is a major histocompatibility complex (MHC) class I–like gene and is located on the short arm of chromosome 6 telomeric to the A3 MHC class 1 histocompatibility locus.
▪
Homozygous mutation of C282Y accounts for approximately 85% to 90% of individuals with HH.
▪
Homozygosity for H63D, another mutation of the HFE gene, is associated with less severe iron overload and rarely results in expression of the clinical phenotype of HH.
▪
C282Y/H63D compound heterozygosity accounts for 5% to 7% of clinically expressed HH.
2.
The HFE gene is expressed primarily in the crypt cells of the duodenum, where it interacts with the transferrin receptor and beta-2 microglobulin.
3.
Hepcidin is a protein thought to play a role in iron metabolism by binding to ferroportin and decreasing iron export from enterocytes and macrophages. In HH, hepcidin expression is decreased, resulting in increased iron absorption from enterocytes and increased release from macrophages.
4.
There is variable penetrance and clinical expression for C282Y homozygotes. Less than 10% will develop end-organ disease.
5.
An effect of modifying genes has also been postulated to contribute to the variable phenotypic disease expression.
View chapterPurchase book
Molecular Testing in Hemochromatosis
P. Brissot, ... A.-M. Jouanolle, in Diagnostic Molecular Pathology, 2017
Conclusions
Molecular testing for the HFE gene is one of the most frequently prescribed genetic tests. In the context of documented tissue iron excess with high plasma TS, the presence of the p.Cys282Tyr mutation in the homozygous state confirms the diagnosis of HFE-related HC. If there is only heterozygosity for p.Cys282Tyr, HFE sequencing should be performed by a specializing center to search for rare compound heterozygosity. If no p.Cys282Tyr mutation is present, rare non-HFE mutations should be tested. NGS technologies will facilitate the study of known genes, but also open the field for discovering new iron-related genes.
View chapterPurchase book
The Neuroendocrine Immune Network in Ageing
Giuseppina Candore, ... Domenico Lio, in NeuroImmune Biology, 2004
3 HLA IB ALLELES IN AGEING
Concerning the class Ib gene HFE, we have recently reported that C282Y mutation may confer a selective advantage in term of longevity to Sicilian women. Interestingly in these subjects an increase of H63D polymorphism was also observed but the difference was not significant [30]. We have not been able to confirm in Sardinian centenarians the increase of C282Y mutation observed in Sicilian oldest old women. This result is not surprising because the HLA AH 7.1, which usually carries this mutation, is virtually absent in the Sardinian population [9]. However, we observed an increase of the other mutation H63D. This trend was not significant, but the cumulative frequency of H63D mutations in centenarian and very old women from Sardinia and Sicily was 22% vs. 11%, i.e. 30/136 vs. 23/210 (P = 0.008) [31].
It is seemingly puzzling that HFE mutations have been suggested to be involved in unsuccessful ageing too. In fact, these mutations have been suggested to be involved in Alzheimer's disease and coronary heart disease, although the data are seemingly contradictory [32,33]. However, it is not surprising that HFE mutations are associated both with longevity and diseases affecting life span. In fact, the available data from genetics of longevity show that longevity may be associated with alleles with increased risk to a variety of diseases in the younger phases of life (antagonistic pleiotropy) [18]. This theory is also a possible explanation for the apparent discrepancy with a recent study performed in Denmark. In a C282Y mutation high-carrier frequency population, as in Denmark, this mutation shows an age-related reduction in the frequency of heterozygotes for C282Y, which suggests that carrier status is associated with shorter life expectancy. The observed reduction in C282Y mutation carrier frequency persists until age 95 years; however, the frequency in the centenarian group was the same as that in the youngest group for both men and women [34]. So, in that study heterozygosity for C282Y has a higher mortality rate in the younger groups but becomes beneficial in the oldest old. On the other hand, in two other European studies, the observed frequency of C282Y homozygosity in oldest old male English and in oldest old male and female Dutch was not significant lower than that predicted [35,36]. All together these reports seem to strongly suggest that HFE effects on ageing depend on interaction between genetic and environmental factors that in different age, gender and population may result in a successful or unsuccessful ageing.
View chapterPurchase book
Applications
Martin Kohlmeier, in Nutrient Metabolism (Second Edition), 2015
The Iron-Regulatory Gene HFE
The protein produced by the HFE gene determines at which blood concentration of diferric transferrin the expression of the hepcidin gene in liver cells starts to increase and the release of iron from the intestine and the reticuloendothelial system is slowed. The C282Y (codon 845 G→A, rs1800562) variant of the HFE protein cannot interact effectively with transferrin 2 (Muckenthaler, 2014), preventing the normal reset of the signaling cascade (by ubiquitination and proteosomal degradation of the BMP receptor type 1). Thus, the signal for hepcidin expression persists without restraint (Ulvik, 2015). The increased hepcidin expression in people with the C282Y variant allows the absorption of large amounts of iron from food even when iron stores are already near or over capacity (Sangwaiya et al., 2011).
Many people of North European ancestry have one or two copies of the C282Y of the HFE gene on the small arm of chromosome 6 (6p21.3), while this variant is rare in people of Asian descent (Beckman et al., 1997; Merryweather-Clarke et al., 1999). In Ireland, nearly one in five newborns are heterozygous for the C282Y variant, and 1% are homozygous (Byrnes et al., 2001). The variant HFE gene product loses its ability to limit iron uptake when stores are filled because it is not effectively processed and moved from the Golgi compartment to the cell surface (Waheed et al., 1997). Since the HFE gene product favors iron uptake, the C282Y variant might confer a selective survival advantage to the offspring of iron-deficient women by enhanced iron transfer across the placenta (Parkkila et al., 1997). The downside of the C282Y variant, particularly in homozygotes, relates to the increased concentration of reactive (unbound) iron and excessive iron accumulation. Affected individuals appear to lose the ability to down-regulate iron absorption when iron stores are sufficient but retain the capacity to up-regulate in response to deficiency (Ajioka et al., 2002). Several other common variants, particularly H63D (rs1799945) and S65C (rs1800730), also compromise HFE function.
The concentration of unbound iron is normally below 10−8 mol/l, which limits oxygen free radical generation and protects against the spread of iron-dependent bacteria in blood and tissues. In more than 1% of the US population the concentration of unbound iron is elevated, as indicated by their very high (>60%) transferrin saturation (Looker and Johnson, 1998). C282Y homozygotes can lower their concentration of unbound iron and prevent excessive iron storage by tightly limiting their iron intake or increasing iron losses (e.g., by blood donation). Chronic excessive iron intake, on the other hand, greatly increases risk (Bell et al., 2000). The C282Y variant also increases transferrin saturation and the tendency to accumulate iron in heterozygotes (Distante et al., 1999).
The health consequences of increased unbound iron in blood can be dramatic. A single serving of raw oysters, which are very commonly contaminated with naturally occurring marine bacteria (Vibrio vulnificus), has infected and killed young homozygotic carriers of the C282Y variant in good health within a few days. Even just handling contaminated seafood or swimming in water with the organisms can be dangerous (Barton and Acton, 2009). Long-term health risks of excessive iron storage include diabetes, cancer, dementia, and premature heart disease. While the risk of heterozygotes tends to be lower compared to homozygotes excessive iron intake compounds their problems. Fatal septicemia following the consumption of infected seafood has occurred in heterozygotes with iron accumulation (Gerhard et al., 2001). Expanded iron stores also increase the risk of colorectal cancer (Nelson, 2001), viral hepatitis (Fargion et al., 2001), and accelerated cognitive decline (Sampietro et al., 2001). The complexity of the issues is underscored, however, by the increased prevalence of C282Y heterozygotes among very old Sicilians (Lio et al., 2002).
Hemochromatosis responds very well to treatment when started at an early age (Islek et al., 2015). Avoidance of iron-fortified dietary supplements and foods, blood donations several times a year (Røsvik et al., 2010), and regular iron status controls are usually sufficient to maintain iron stores in the normal range.
View chapterPurchase book
Disorders of Iron Overload
Antonello Pietrangelo, Michael Torbenson, in Macsween's Pathology of the Liver (Seventh Edition), 2018
Ferroportin disease
After the identification of the HFE gene, it rapidly became apparent that significant numbers of iron overload disorders could not be explained by HFE mutations, particularly in Europe, where C282Y homozygosity was responsible for 90% of cases in the United Kingdom and Brittany but only 64% and 30% in the southern European countries of Italy and Greece, respectively.173 Occasional cases could be explained by mutation of TfR2 or HJV/HAMP, but a more common disease was related to abnormalities of the iron-exporter ferroportin.6–8
Previous studies had identified an autosomal dominant iron overload condition in a large family from Italy.69 In the wake of the discovery of ferroportin, genome-wide screening procedures confirmed that these same patients were affected by a candidate gene on 2q32, SLC40A1, previously named SLC11A3. All were heterozygous for a c.230 C→A substitution resulting in the replacement of alanine 77 with aspartate.105 This was subsequently known as ferroportin disease.140
Ferroportin encodes a transmembrane transporter with iron-responsive element (IRE) function that acts as an iron exporter. The pathogenesis is thus quite different from that of hereditary HC. Ferroportin is directly involved in the release of iron from macrophages, and mutations of SLC40A1 represent the mechanism leading to the ferroportin disease. Various mutations of the gene have been identified with similar outcomes, leading to the conclusion that the basic mechanism is a net loss of protein function.140
All mutations are of missense type and, depending on the mutation, the mutant ferroportin can affect the cellular location of the wild-type protein. Loss of iron export function is likely caused by mislocalization of the mutant protein, with the protein localizing in an intracellular distribution, as opposed to the normal membranous display. In this situation, there is no binding to hepcidin or hepcidin-induced degradation. The resultant reduction in iron efflux due to haploinsufficiency does not appear to limit iron transfer in cells exposed to low iron traffic (e.g. enterocytes). However, it causes a bottleneck in macrophages, which generate the largest iron flow, resulting in iron accumulation in Kupffer cells and macrophages with high ferritin levels and low to normal Tf saturation.
Numerous mutations of the ferroportin gene have been identified, with divergent findings with respect to the pattern of ferritin/transferrin dissociation in probands of French-Canadian, Melanesian, Thai and European heritage,140,174–176 which explains the in vitro findings previously discussed. Clinical presentation thus appears heterogeneous. Ferroportin disease, as originally described, may manifest with a milder phenotype than classic HC. The associated liver disease is usually not as severe. Depending on the mutation, serum ferritin increases early in the disease despite low to normal Tf saturation, the opposite picture to classic HC. Hypochromic anaemia is common and may require iron supplementation, which may further exacerbate the iron overload.
In the ferroportin disease originally described, the early stage demonstrates Kupffer cell iron overload, increasing over time with often large and coalescent deposits in Kupffer cells and macrophages and some deposition in hepatocytes (Fig. 4.12 A). In FPN-associated HC (erroneously classified as 'ferroportin disease type B' by OMIM), in contrast, there is evidence of primary hepatocyte loading (Fig. 4.12 B).
Although venesection is again the cornerstone of therapy, it may not be tolerated equally in all patients, and low Tf saturation with anaemia may be rapidly established despite serum ferritin still being elevated. If phlebotomy is discontinued, there is a rapid increase in the ferritin level, and both oral chelation and erythropoietin may be of some benefit.140 Ferroportin disease must be suspected in any individual with unexplained hyperferritinaemia and investigated with serum iron studies and genetic testing, if available, of the immediate family.