Chereads / God from past / Chapter 18 - Genetic mutation

Chapter 18 - Genetic mutation

But in other corner of Castle away from all these hubbub in a room, a young man was sitting on his bed and meditating, Like he was free from all worries of world. After some time.

Ronnie opened his eyes with his eyes furrowed," ah now I have organised all my memory properly and also checked the condition of this body and it is really very bad. This body is poisoned from birth and all the spirit seeds are destroyed that's why this body cannot absorb manna. Huh !who can be so cruel to poision a unborn baby and whoever they are not only they are cruel but they also c hate him very much because it was easy to kill him but they didn't kill him by poison, they wanted to make him suffer, that's why only destroyed spirit seeds and let him live a painful life."

"First thing is to clear poison then ,

second to obtain spirit seeds and

third to take revenge for this bodies original owner and

4th to reach to my past level but all of this will need lots of money and 4th duke house is already broke"

"Ah! Fuck!! what to do , what to do; in my past life , I was always walked on righteous path and never offended anyone but still after 4000 years of hard work I was not able to escape from the chains of fate and died unexpectedly, I will change everything , I will change everything in this life even my fate and destiny will be charged this time , no more righteousness, no more not offending anyone, I will reach to my goal at any cost even, if I have to plunder the heavens himself for this I will not backout, if heavens have guts then they can try to punish me ."

Ronnie was thinking all of this and how to deal with his problems , He started to dig in his knowledge of past life when science was able to find out the truth behind supernatural powers by very long research.

Knowledge which is already lost , he thought ( actually ,spirit seeds they all are talking about are nothing but special dna sequences , dna is genetic material present in every living being made up of Adenine , thymine, guanine and cytosine .

So they make millions of dna sequence in body and every cell of body have it's dna and they are made up of sequences like ATGCATCGTGCATGACCATGAC like structure and these dna sequence are responsible all the body function like hair color to body muscles and some of these responsible dna sequences are known as gene and some of these genes are responsible for absorption of different type of manna in humans and these genes are known as "God genes" .

As it is said that humans are made in picture of God and these god genes are genes which were similar to dna sequences of gods.

All males have XY gene and females have XX gene so when they give birth to child , there children get X or Y gene from father and X gene from mother for example father have X1Y1 genes and mother have X2X2 genes so there son and daughter will get X1Y2 genes or X1X2 gene among this 2 gene , one gene will be dominant and other will be silent so whichever gene is dominant will decide which manna element, it's owner can absorb. That's why almost every one can only absorb one element and in very few cases, There is possibility of both genes are equally dominant or equally silent in only those cases person can have 2 elements. Sometime genetic mutation can happen randomly in only that case 3 elements can possible like they can have XYY OR XXY etc in place of normal sequence but still it will limit there growth and some time mutation can also harm life of owner .